13ο Τοπικό Διαγωνισμό Φυσικών Επιστημών EUSO 2015

Οι μαθητές της Β΄Λυκείου Θετικής Κατεύθυνσης που θα λάβουν μέρος στον 13ο Τοπικό Διαγωνισμό Φυσικών Επιστημών EUSO 2015 μετά από απόφαση του Τομέα Φυσικών Επιστημών, είναι οι παρακάτω:
  • Μπασδέκη Πολυτίμη
  • Ρούσση Μαρία
  • Γαβανάς Νίκος
  • Μοντίνος Θοδωρής
Η επιλογή της ομάδας έγινε από τα μέλη του Τομέα Φυσικών Επιστημών με βάση:
  • Βαθμολογικές επιδόσεις 
  • Εργαστηριακές στάσεις 
  • Μαθησιακές δεξιότητες 
  • Παιδαγωγικές τάσεις 
  • Διακρίσεις σε άλλους διαγωνισμούς 
Ο τοπικός διαγωνισμός θα διεξαχθεί το Σάββατο 6 Δεκεμβρίου 2014 στο ΓΕΛ Καλλίπολης. Οι ομάδες που θα επιλεγούν από όλους τους τοπικούς διαγωνισμούς, θα συμμετάσχουν στη δεύτερη και τελική φάση του διαγωνισμού. Στις 24 Ιανουαρίου 2015, στο Ε.Κ.Φ.Ε. Αιγάλεω, στην Αθήνα και στον οποίο θα συμμετάσχουν οι μαθητικές ομάδες που προκρίθηκαν από τους τοπικούς Διαγωνισμούς των ΕΚΦΕ. Από τον κάθε τελικό διαγωνισμό θα επιλεγεί μια τριμελής ομάδα μαθητών που θα συμμετάσχει στην 13η Ευρωπαϊκή Ολυμπιάδα Επιστημών - EUSO 2015, η οποία θα πραγματοποιηθεί στo Klagenfurt της Αυστρίας από 26 Απριλίου μέχρι 3 Μαΐου 2015.

Διευθύνσεις ιστοσελίδων για περισσότερες πληροφορίες: https://www.facebook.com/euso2014
http://ekfe-a-peiraia.att.sch.gr/Euso.html

O Υπεύθυνος Τομέα Φ.Ε. 
Κορίτσογλου Π. 

Οι καθηγητές
Αντωνόπουλος Α.
Ανδρεαδάκης Δ.
Μιχαλίτση Π.
Χατζαντωνά Ά.

Εννοιολογικός χάρτης για την επανάληψη του νευρικού συστήματος

Βιολογία Α΄Λυκείου 
Κεφάλαιο 9
Κάντε κλικ στην παρακάτω εικόνα για να κατεβάσετε το αρχείο σε μορφή jpeg


ή μεταβείτε στον παρακάτω σύνδεσμο: 

file:///C:/Users/anna/Desktop/%CE%9D%CE%95%CE%A5%CE%A1%CE%99%CE%9A%CE%9F%20%CE%A3%CE%A5%CE%A3%CE%A4%CE%97%CE%9C%CE%91.html 

Τοπικός προκριματικός διαγωνισμός εργαστηριακών δεξιοτήτων για επιλογή των μαθητών που θα συμμετάσχουν στη 13η Ευρωπαϊκή Ολυμπιάδα Επιστημών EUSO 2015

Το ΕΚΦΕ Πειραιά – Καλλίπολης στα πλαίσια του Πανελληνίου Μαθητικού Διαγωνισμού για την επιλογή ομάδων μαθητών που θα συμμετάσχουν στην 13η Ευρωπαϊκή Ολυμπιάδα Επιστημών - EUSO 2015, διοργανώνει τοπικό προκριματικό διαγωνισμό εργαστηριακών δεξιοτήτων στα μαθήματα Φυσικής, Χημείας και Βιολογίας για μαθητές ΓΕ.Λ. και ΕΠΑ.Λ., που έχουν γεννηθεί μετά την 01-01-1998. Ο τοπικός διαγωνισμός θα διεξαχθεί το Σάββατο 6 Δεκεμβρίου 2014 στο ΓΕΛ Καλλίπολης. Οι ομάδες που θα επιλεγούν από όλους τους τοπικούς διαγωνισμούς, θα συμμετάσχουν στη δεύτερη και τελική φάση του διαγωνισμού. Στις 24 Ιανουαρίου 2015, στο Ε.Κ.Φ.Ε. Αιγάλεω, στην Αθήνα και στον οποίο θα συμμετάσχουν οι μαθητικές ομάδες που προκρίθηκαν από τους τοπικούς Διαγωνισμούς των ΕΚΦΕ. Από τον κάθε τελικό διαγωνισμό θα επιλεγεί μια τριμελής ομάδα μαθητών που θα συμμετάσχει στην 13η Ευρωπαϊκή Ολυμπιάδα Επιστημών - EUSO 2015, η οποία θα πραγματοποιηθεί στo Klagenfurt της Αυστρίας από 26 Απριλίου μέχρι 3 Μαΐου 2015.

Θέματα Τοπικών Προκριματικών Διαγωνισμών του ΕΚΦΕ Καλλίπολης από εδώΠαλαιότερα θέματα του διαγωνισμού EUSO και πληροφορίες για τον διαγωνισμό, θα βρείτε εδώ
Διεύθυνση EUSO 2014 Athens fb: https://www.facebook.com/euso2014 

Οι μαθητές της Β΄Λυκείου που επιθυμούν να λάβουν μέρος,  να ενημερώσουν στο γραφείο Φυσικών Επιστημών. 

Για τους μαθητές της Γ΄Λυκείου Θετικής Κατεύθυνσης

Κεφάλαιο 4ο 
Πιθανοί τρόποι σύνδεσης συνεχούς γονιδίου σε πλασμίδιο στο οποίο έχει ενσωματωθεί υποκινητής.
Κατεβάστε το αρχείο σε word ή pdf

2ος Πανελλήνιος Μαθητικός Διαγωνισμός για τον Έλεγχο του Καπνίσματος

Μαθητές Γυμνασίου 
Σχολικό έτος: 2014-2015
"Η ΑΡΧΗ ΤΟΥ ΤΕΛΟΥΣ" 
Το κάπνισμα βλάπτει την υγεία
Σοβαρά, δεν είναι αστεία.
Προκαλεί ασθένειες πολλές
Δύσκολες και επώδυνες.
Το κάπνισμα σκοτώνει
Και τον οργανισμό σου αποδυναμώνει.
Καπνίζεις εσύ σε χώρο κλειστό,
Παθητικά καπνίζω και εγώ.
Έπεται και συνέχεια... 

2ος Πανελλήνιος Μαθητικός Διαγωνισμός για τον Έλεγχο του Καπνίσματος

Κάντε κλικ εδώ
Οι μαθητές που θέλουν να λάβουν μέρος στον διαγωνισμό 
να απευθυνθούν σε καθηγητή του Τομέα Φυσικών Επιστημών

Αποτελέσματα πανελληνίων εξετάσεων 2014 μαθητών Eκπαιδευτικού Oργανισμού "Θεμιστοκλής"

Κάντε κλικ εδώ
Συγχαρητήρια και καλή σταδιοδρομία σε όλους τους επιτυχόντες! 
Δείτε τις βάσεις εισαγωγής 2014 σε ΑΕΙ και ΤΕΙ  εδώ

Αποτελέσματα πανελληνίων μαθητών "Θεμιστοκλή"

Μπράβο στους μαθητές μας για τις βαθμολογίες που μας έφεραν! 
Μπράβο για την προσπάθεια τους όλη την χρονιά! 
Ευχόμαστε τα αποτελέσματα που προσδοκούν! 

Δείτε τις βαθμολογίες των μαθητών του σχολείου μας κάνοντας κλικ εδώ

Τα κοάλα αγκαλιάζουν τα δέντρα για να δροσιστούν...

Ας ξεκουράσουμε λίγο το μυαλό μας από τις πανελλήνιες εξετάσεις 
με κάτι όμορφο και ευχάριστο...

Η εικόνα γνωστή. Το κοάλα γέρνει και αγκαλιάζει σχεδόν στοργικά τον κορμό του δέντρου. Γιατί όμως συμβαίνει αυτό; Απάντηση στη συνήθεια των χαριτωμένων ζώων αποφάσισαν να δώσουν οι επιστήμονες, με επικεφαλής ερευνητές από το Πανεπιστήμιο της Μελβούρνης.

Χρησιμοποιώντας θερμικές κάμερες, οι ειδικοί παρατήρησαν ότι τις μέρες που ο υδράργυρος ανέβαινε, τα κοάλα κατέβαιναν σε πιο χαμηλά και δροσερά σημεία των δέντρων, ενώ έτειναν να κολλάνε το σώμα τους πιο κοντά στον κορμό τους.
Διαβάστε περισσότερα: εδώ

Eνδεικτικές απαντήσεις στα θέματα Πανελληνίων Βιολογίας Θετικής Κατεύθυνσης Γ΄Λυκείου 2014

ΘΕΜΑ Α
Α1. δ
Α2. γ
Α3. β
Α4. γ
Α5. β

ΘΕΜΑ Β

Β1. 
4-2-1-6-3-5

Β2. 
α. DNA πολυμεράση
β. Πριμόσωμα
γ. DNA δεσμάση
δ. DNA ελικάση
ε. RNA πολυμεράση

Β3. 
Η διάγνωση των γενετικών ασθενειών μπορεί να πραγματοποιηθεί :
• Με τη μελέτη του καρυοτύπου, όπως για παράδειγμα κατά τον προγεννητικό έλεγχο.
• Με διάφορες βιοχημικές δοκιμασίες.
• Με την ανάλυση της αλληλουχίας των βάσεων του DNA (μοριακή διάγνωση).

Β4. Διαγονιδιακά ονομάζονται τα ζώα εκείνα στα οποία έχει τροποποιηθεί το γενετικό υλικό τους με την προσθήκη γονιδίων, συνήθως από κάποιο άλλο είδος.

Β5. 
Με τον όρο ζύμωση εννοούμε τη διαδικασία ανάπτυξης μικροοργανισμών σε υγρό θρεπτικό υλικό κάτω από οποιεσδήποτε συνθήκες. Τα προϊόντα της ζύμωσης είναι είτε τα ίδια τα κύτταρα που ονομάζονται βιομάζα είτε προϊόντα των κυττάρων όπως πρωτεΐνες και αντιβιοτικά.

ΘΕΜΑ Γ
Γ1.
Σε κάθε περίπτωση κάνουμε χρήση του 1ου νόμου του Mendel σύμφωνα με τον οποίο:
(Ο τρόπος με τον οποίο κληρονομούνται οι χαρακτήρες τους οποίους μελέτησε ο Mendel είναι αποτέλεσμα των γεγονότων που συμβαίνουν στη μείωση. Κατά την παραγωγή των γαμετών διαχωρίζονται τα δύο ομόλογα χρωμοσώματα και συνεπώς και τα δύο αλληλόμορφα γονίδια. Σε ένα φυτό γονότυπου Αα, για παράδειγμα, σχηματίζονται δύο ειδών γαμέτες, Α και α, σε ίση αναλογία. Οι απόγονοι προκύπτουν από τον τυχαίο συνδυασμό των γαμετών. Η κατανομή των αλληλόμορφων στους γαμέτες και ο τυχαίος συνδυασμός τους αποτελεί τον πρώτο νόμο του Mendel ή νόμο του διαχωρισμού των αλληλόμορφων γονιδίων.)
1η περίπτωση:
Έστω ότι η μονογονιδιακή ασθένεια οφείλεται σε επικρατές γονίδιο:
Σε αυτή την περίπτωση δύο υγιείς γονείς περιέχουν στον γονότυπο τους μόνο υπολειπόμενα γονίδια και σύμφωνα με τον 1ο νόμο του Mendel είναι αδύνατον να αποκτήσουν παιδί ασθενές, μιας και οι ασθενείς από επικρατή μονογονιδιακή ασθένεια έχουν τουλάχιστον ένα επικρατές γονίδιο. Παρατηρώντας συνεπώς το γενεαλογικό δένδρο οι γονείς Ι1 και 12 είναι υγιείς και αποκτούν παιδί τον ΙΙ3 που νοσεί. Άρα αποκλείεται η επικρατής κληρονομικότητα.

2η περίπτωση
Έστω ότι η μονογονιδιακή ασθένεια οφείλεται σε υπολειπόμενο γονίδιο:
Σε αυτή την περίπτωση δύο υγιείς γονείς περιέχουν στον γονότυπο τους τουλάχιστον ένα επικρατές γονίδιο και σύμφωνα με τον 1ο νόμο του Mendel μπορούν να  αποκτήσουν παιδί ασθενές, μιας και οι ασθενείς από υπολειπόμενη μονογονιδιακή ασθένεια έχουν μόνο υπολειπόμενα γονίδια που είναι δυνατόν να έχουν κληροδοτήσει από τους υγιείς γονείς. Παρατηρώντας συνεπώς το γενεαλογικό δένδρο οι γονείς Ι1 και Ι2 είναι υγιείς και αποκτούν παιδιά υγιή (ΙΙ1, ΙΙ2, ΙΙ4) και παιδί που νοσεί (ΙΙ3). Οι γονείς ΙΙ4  και ΙΙ5 ο ένας νοσεί και ο άλλος είναι υγιής ενώ ο απόγονος τους ΙΙΙ3 νοσεί, κάτι που είναι δυνατό μέσω του 1ου νόμου του Mendel να συμβεί στην περίπτωση που ο ένας εκ των δύο γονέων είναι ετερόζυγος όπως αποδεικνύεται και παρακάτω (μόνο στην αυτοσωμική κληρονομικότητα). Η υπόθεση είναι αποδεκτή.

Γ2.
1η περίπτωση:
Έστω ότι η μονογονιδιακή ασθένεια οφείλεται σε αυτοσωμικό γονίδιο:
Έχουμε αποδεχθεί ότι η ασθένεια κληρονομείται με υπολειπόμενο τρόπο.

Συμβολισμός :
Α: υγιής
α: νοσεί

Τα άτομα του γενεαλογικού δένδρου έχουν γονότυπο:
Ι1 : Αα
Ι2 : Αα
ΙΙ1: ΑΑ ή Αα
ΙΙ2 : ΑΑ ή Αα
ΙΙ3 :αα
ΙΙ4 : Αα
ΙΙ5 : αα
ΙΙΙ1: αα
Με βάση τον 1ο νόμο του Mendel, ο Ι1 και ο Ι2 έχουν γονότυπο Αα, εφόσον αποκτούν τον ΙΙ3 ο οποίος έχει γονότυπο αα και νοσεί. Επίσης οι απόγονοι ΙΙ1,ΙΙ2, ΙΙ4 έχουν δύο πιθανούς εναλλακτικούς γονότυπους, όπως φαίνεται παραπάνω. Από τον γάμο του ΙΙ4 και του ΙΙ5 γεννιέται απόγονος ο ΙΙΙ1 ο οποίος νοσεί κατά συνέπεια ο ΙΙ4 είναι ετερόζυγος (Αα).

Διασταυρώσεις:
Ρ: Ι1 x I2
Ρ: ♂Αα   x   ♀Αα
Γαμέτες: ♂Α, α   x   ♀ Α, α

F:
Α
α
Α
ΑΑ
Αα
α
Αα
αα


Ρ: ΙΙ4 x ΙΙ5
Ρ: ♂Aα  x ♀αα
Γαμέτες: ♂A, α  x ♀ α

F:
α
Α
Αα
α
αα

Η υπόθεση είναι αποδεκτή.

2η περίπτωση:
Έστω ότι η μονογονιδιακή ασθένεια οφείλεται σε φυλοσύνδετο γονίδιο:
Έχουμε αποδεχθεί ότι η ασθένεια κληρονομείται με υπολειπόμενο τρόπο.

Συμβολισμός:
ΧΑ:
Χα:
Τα άτομα του γενεαλογικού δένδρου έχουν γονότυπο:

ΙΙ4 : ΧΑΥ
ΙΙ5 : ΧαΧα
ΙΙΙ1:ΧαΧα

Με βάση τον 1ο νόμο του Μέντελ και λαμβάνοντας υπόψη ότι οι φυλοσύνδετες ιδιότητες βρίσκονται πάνω στο Χ χρωμόσωμα και δεν έχουν αλληλόμορφο στο Υ, η αρχική υπόθεση απορρίπτεται εφόσον είναι αδύνατον να γεννηθεί κορίτσι που νοσεί από πατέρα υγιή.

ΣΥΜΠΕΡΑΣΜΑΤΙΚΑ Η ΜΟΝΟΓΟΝΙΔΙΑΚΗ ΙΔΙΟΤΗΤΑ ΟΦΕΙΛΕΤΑΙ ΣΕ ΑΥΤΟΣΩΜΙΚΟ ΥΠΟΛΕΙΠΟΜΕΝΟ ΓΟΝΙΔΙΟ

Γ3.
Τα άτομα του γενεαλογικού δένδρου έχουν γονότυπο:
Ι1 : Αα
Ι2 : Αα
ΙΙ1: ΑΑ ή Αα
ΙΙ2 : ΑΑ ή Αα
ΙΙ3 :αα
ΙΙ4 : :Αα
ΙΙ5 : αα
ΙΙΙ1: αα

Γ4.

Οι γονότυποι των ατόμων ΙΙ1 και ΙΙ2 με βάση τους ανιχνευτές είναι ΑΑ και Αα αντίστοιχα.
(Αν επιδράσουμε στο DNA που απομονώθηκε με κατάλληλες χημικές ουσίες ή αυξήσουμε τη θερμοκρασία τότε σπάζουν οι δεσμοί υδρογόνου μεταξύ των δύο συμπληρωματικών αλυσίδων και οι δύο αλυσίδες αποχωρίζονται η μία από την άλλη. Η διαδικασία αυτή λέγεται αποδιάταξη. Οι δύο μονόκλωνες συμπληρωματικές αλυσίδες σε κατάλληλες συνθήκες μπορούν να επανασυνδεθούν. Στην ιδιότητα αυτή στηρίζεται η διαδικασία της υβριδοποίησης που είναι η σύνδεση μονόκλωνων συμπληρωματικών αλυσίδων DNA ή συμπληρωματικών DNA-RNA. Η υβριδοποίηση είναι μια πολύ σημαντική ιδιότητα του DNA που μας δίνει τη δυνατότητα αν έχουμε ένα γνωστό μόριο DNA, να το χρησιμοποιήσουμε ως ανιχνευτή για τον εντοπισμό του συμπληρωματικού του όταν το τελευταίο βρίσκεται μαζί με χιλιάδες άλλα κομμάτια.
Η τεχνική της ανίχνευσης που χρησιμοποιείται συνήθως περιλαμβάνει τη χρήση μονόκλωνων ιχνηθετημένων ανιχνευτών μορίων DNA ή RNA που περιέχουν αλληλουχίες συμπληρωματικές προς το DNA που αναζητούμε.)

Εφόσον στον ΙΙ1 δεν ανιχνεύτηκε το μεταλλαγμένο με τη βοήθεια του ανιχνευτή άρα ο γονότυπος του ατόμου είναι ΑΑ, ενώ του ΙΙ2 δείχνει ότι το άτομο είναι ετερόζυγο εφόσον ο ανιχνευτής υβριδοποιείται με ένα μόριο.

Γ5.
Το σύνδρομο Kleinefelter  έχει γονότυπο ΧΧΥ και όταν το άτομο αυτό πάσχει από μερική αχρωματοψία τότε ο γονότυπο του γίνεται ΧαΧαΥ, εφόσον η μερική αχρωματοψία κληρονομείται με φυλοσύνδετο υπολειπόμενο τρόπο.

Οι γονείς είναι υγιείς άρα ο γονότυπος τους θα είναι:

♂ ΧΑΧα εφόσον μόνο αν η μητέρα είναι ετερόζυγη, είναι εφικτή η γέννηση ατόμου με μερική αχρωματοψία.

♀ΧΑΥ
Έτσι ένα άτομο ΧαΧαΥ μπορεί να προκύψει από τους παραπάνω γονείς αν συμβεί μη σωστός διαχωρισμός των αδελφών χρωματίδων στην ΙΙ μειωτική διαίρεση της μητέρας (ωογένεση). Έτσι προκύπτει μη φυσιολογικός γαμέτης (ωάριο) με ΧαΧα χρωμοσώματα (+1 παραπάνω). Η σπερματογενέση (μείωση) του πατέρα γίνεται φυσιολογικά. Έτσι ένα φυσιολογικό σπερματοζωάριο με 1Υ χρωμόσωμα αν γονιμοποιήσει το μη φυσιολογικό ωάριο ΧαΧα θα προκύψει ζυγωτό ΧαΧαΥ, το οποίο έχει σύνδρομο Kleinefelter και μερική αχρωματοψία.

Η απάντηση μπορεί να δοθεί και με διαγραμματική απεικόνιση των μειωτικών διαιρέσεων αρκεί πάνω στο σχήμα ο μαθητής να δίνει όλες τις απαραίτητες εξηγήσεις.

ΘΕΜΑ Δ
Δ1.

5 ΄ AGCT- ATG-ACC-ATG-ATT-ACG-GAT-TCA-CTG 3΄ αλυσίδα Ι
3΄  TCGA- TAC-TGG-TAC-TAA-TGC-CTA-AGT-GAC 5΄ αλυσίδα ΙΙ

Κωδική είναι η αλυσίδα Ι και μη κωδική η αλυσίδα ΙΙ. Διαβάζοντας την αλυσίδα Ι με κατεύθυνση 5προς3 βρίσκουμε το κωδικόνιο έναρξης 5ATG 3 και προχωρώντας με βήμα τριάδας με τρόπο συνεχή και μη επικαλυπτόμενο έχουμε τα 7 κωδικόνια που κωδικοποιούν μαζί με το κωδικόνιο έναρξης που κωδικοποιεί την μεθειονίνη τα 8 πρώτα αμινοξέα του πρώτου δομικού γονιδίου του οπερονίου της λακτόζης.

Δ2.
Το τμήμα του m RNA που προκύπτει είναι :
5΄ ΑGCUAUGACCAUGAUUACGGAUUCACUG

Η RNA Pol συνδέεται πάνω στον υποκινητή με τη βοήθεια μεταγραφικών παραγόντων και συνθέτει ένα m RNA με καλούπι τη μη κωδική αλυσίδα και κατεύθυνση 5΄προς3΄. Έτσι το m RNA είναι συμπληρωματικό και αντιπαράλληλο με τη μη κωδική αλυσίδα.

Δ3. Το τμήμα του m RNA που θα συνδεθεί η μικρή υπομονάδα του ριβοσώματος είναι η 5΄αμετάφραστη περιοχή του m RNA:

AGCU3΄

Δ4. Στο παραπάνω τμήμα DNA μπορεί να οδηγήσει σε σύνθεση πρωτεΐνης με 1022 αντί 1024 αμινοξέα, δηλαδή κατά δύο αμινοξέα μικρότερη, η αντικατάσταση μιας βάσης στο κωδικόνιο έναρξης. Οποιαδήποτε αντικατάσταση μιας βάσης στο 5΄ATG 3΄ μιας και αυτό δεν έχει συνώνυμα κωδικόνια οδηγεί στην αλλαγή του. Συνεπώς η το m RNA μεταφράζεται από το επόμενο κωδικόνιο 5΄ΑTG3΄ που εντοπίζεται δύο τριπλέτες μετά από το 1ο κωδικόνιο έναρξης, οπότε η πρωτεΐνη που παράγεται είναι κατά δύο αμινοξέα μικρότερη.

Δ5.

Η προσθήκη τεσσάρων νουκλεοτιδίων μεταξύ 3ου και 4ου κωδικονίου στο ρυθμιστικό γονίδιο του οπερονίου, εφόσον πρόκειται για προσθήκη βάσεων διαφορετικό του πολλαπλασίου του 3 οδηγεί σε αλλαγή των κωδικονίων του m RNA. Έτσι καθώς το τροποποιημένο m RNA μεταφράζεται, παράγεται μια διαφορετική πρωτεΐνη καταστολέας, η οποία είναι μη λειτουργική. Συνεπώς είναι αδύνατη η σύνδεση του καταστολέα με τον χειριστή. Η RNA πολυμεράση συνδέεται με τον υποκινητή του οπερονίου και μεταγράφει τα δομικά γονίδια, εφόσον δεν μπλοκάρεται από το σύμπλοκο χειριστής – καταστολέας.  Τα γονίδια απουσία λακτόζης και γλυκόζης εκφράζονται συνεχώς και τα ένζυμα παράγονται συνέχεια παρά την απουσία λακτόζης από το θρεπτικό υλικό. 

Μια τελευταία ματιά στη Βιολογία Θετικής Κατεύθυνσης Γ΄Λυκείου

Κάντε κλικ εδώ για να κατεβάσετε το word 
Κάντε κλικ εδώ για να κατεβάσετε το pdf 

a little DNA joke... ode to my 5 years of Biology