Συνδυαστική άσκηση κεφάλαια 1-2-5-6


A)Αρσενικό άτομο ενός διπλοειδούς είδους Μ έχει καρυότυπο 26(ΑΑ) Α18Α18Α18 ΧΥ. Το γράμμα Α αντιστοιχεί στα αυτοσωμικά χρωμοσώματα. Αν θεωρήσουμε ότι ο φυλοκαθορισμός γίνεται όπως και στον άνθρωπο, ονομάστε το είδος της γενετικής ασθένειας.
Πόσα μόρια DNA υπάρχουν στον παραπάνω καρυότυπο του ατόμου, πόσα σε ένα πιθανό σπερματοζωάριο αυτού του ατόμου και πόσα σε ένα σπερματοζωάριο φυσιολογικού ατόμου του ίδιου είδους;

Β) Πάνω στο 18ο χρωμόσωμα του παραπάνω οργανισμού εδράζεται γονίδιο που ελέγχει ένα χαρακτήρα (χαρακτήρας Ζ). Στη διάρκεια της εξέλιξης του είδους το γονίδιο αυτό έχει μεταλλαχθεί δύο φορές με διαφορετικό τρόπο (μεταλλαγμένο γονίδιο Ζ1- μεταλλαγμένο γονίδιο Ζ2), δίνοντας δύο διαφορετικές παραλλαγές του χαρακτήρα Ζ. Το μεταλλαγμένο γονίδιο Ζ1 δίνει τον χαρακτήρα Ζ1 και το μεταλλαγμένο γονίδιο Ζ2 δίνει τον χαρακτήρα Ζ2.

Το παρακάτω σχήμα δείχνει την κωδική και μη κωδική αλυσίδα του φυσιολογικού γονιδίου Ζ και το φυσιολογικό πεπτίδιο που αυτό κωδικοποιεί:

ΦΥΣΙΟΛΟΓΙΚΟ ΓΟΝΙΔΙΟ Ζ:

ΑΤATAATTTAGTGGTACCGCCCCCCCCAGCCCGGGGTAAAA
TATATTAAATCACCATGGCGGGGGGGGTCGGGCCCCATTTT

ΦΥΣΙΟΛΟΓΙΚΟ ΠΕΠΤΙΔΙΟ Ζ:

ΝΗ2- met- gly- pro-glu-pro-trp- COOH

Επίσης δίνονται οι δύο μεταλλαγμένες πρωτεΐνες (Ζ1-Ζ2):

ΜΕΤΑΛΛΑΓΜΕΝΗ ΠΡΩΤΕΙΝΗ Ζ1:

NH2- met-gly- arg-ser-glu-pro-trp-COOH

ΜΕΤΑΛΛΑΓΜΕΝΗ ΠΡΩΤΕΙΝΗ Ζ2:

NH2- met-gly-pro-COOH

Υποδείξτε ένα πιθανό μηχανισμό μετάλλαξης για καθένα από τα δύο παραπάνω μεταλλαγμένα γονίδια Ζ1 και Ζ2. Kαι στις δύο μεταλλάξεις το μήκος της πολυνουκλεοτιδικής αλυσίδας έχει αλλάξει.

Δίνονται: GGGàgly, CCC, CCAà pro, GAGàglu, CGAàarg, UCCà ser, UGGàtrp


Γ3) Τα δύο μεταλλαγμένα γονίδια είναι υπολειπόμενα σε σχέση με το επικρατές φυσιολογικό γονίδιο Ζ ενώ μεταξύ τους έχουν σχέση συνεπικράτειας (Ζ1=Ζ2)<Ζ.

Πως ονομάζονται οι διαφορετικές μορφές – παραλλαγές του φυσιολογικού γονιδίου και εξηγήστε γιατί σε αυτές τις περιπτώσεις δεν ισχύουν οι αναλογίες του 1ου νόμου του Mendel;

Πόσοι διαφορετικοί γονότυποι και φαινότυποι για τον συγκεκριμένο χαρακτήρα υπάρχουν στο είδος Μ;               

Γ4) Ποιοι οι πιθανοί γαμέτες ενός ατόμου του είδους Μ που δεν έχει χρωμοσωμική ανωμαλία και έχει φαινότυπο Ζ1Ζ2 αν:
-Δεν γίνει σωστός διαχωρισμός του 18ου ζεύγους ομολόγων χρωμοσωμάτων στην 1η μείωση;
-Δεν γίνει σωστός διαχωρισμός των αδελφών χρωματίδων του ενός εκ των δυο 18ου χρωμοσωμάτων στην 2η μείωση;