Άσκηση με οπερόνιο λακτόζης

Το παρακάτω διάγραμμα δείχνει τις μεταβολές στη συγκέντρωση της γλυκόζης (καμπύλη Β), της ανάπτυξης του βακτηρίου E.coli (καμπύλη Α) και τη συγκέντρωση ενός εκ των ενζύμων διάσπασης της λακτόζης (περμεάση -καμπύλη Γ):
Καμπύλη Α: ανάπτυξη βακτηρίου E. coli
Καμπύλη Β: γλυκόζη
Καμπύλη Γ: περμεάση
Στο θρεπτικό υλικό προσθέσαμε αρχικά (t=0΄)γλυκόζη και λακτόζη.


Aπαντήστε στις ερωτήσεις:
Aν τα παρακάτω mRNA αποτελούν προϊόντα μεταγραφής του οπερονίου της λακτόζης, ποια χρονικά διαστήματα από το t=0 έως t=200 min, απομονώσαμε από το βακτήριο, το καθένα από τα παρακάτω m RNA:

i) 3΄ AAAAGUGGGGAGCGCGAAAGAGUAAAAA

ii)3΄AAGUGGGGAGGUAAAGUGGAGACGCCAGCGUAAAAAGUGGAGCGGUAAAAA5΄


Αιτιολογήστε την απάντησή σας